circad | circRNAs associated with diseases

circAGFG1
Gene	AGFG1	Organism	Human
Genome Locus		Build	hg19
Disease	Breast Cancer	ICD-10	Malignant neoplasm of breast (C50)
DBLink	Link to database	PMID	30621700
Experimental Method
Sample Type	Tissue and cell lines	Comparison	40 pairs of TNBC tissues and adjacent non-cancerous tissues including 4 pairs of samples for RNA-seq were collected from patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCAGTTGTAGGTCGTTCTCAAG Reverse GGATTTAATCCTCGCCTGCATG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Yang, R, Xing, L, Zheng, X, Sun, Y, Wang, X, Chen, J (2019). The circRNA circAGFG1 acts as a sponge of miR-195-5p to promote triple-negative breast cancer progression through regulating CCNE1 expression. Mol. Cancer, 18, 1:4.